Date of Award

Spring 1993

Document Type

Dissertation

Degree Name

Doctor of Philosophy (PhD)

Department

Chemistry and Biochemistry

Program/Concentration

Biomedical Sciences

Committee Director

Christopher J. Osgood

Committee Member

Frank J. Castora

Committee Member

Mark S. Elliot

Committee Member

Timothy J. Bos

Abstract

Copia, a Drosophila retrotransposon, is constitutively expressed in all developmental stages, except the embryo in Drosophila melanogaster. The effect of random integration of the copia element results in phenotypic change in Drosophila. The regulatory sequences, controlling copia expression, are located within the 5'LTR. The DNA sequence in the 5'LTR and in the location between downstream of entire the 5' LTR and the initial translation site have been identified by mobilityshift binding assays and DNase I footprinting assays. The data reveals three protected regions: a TATA-binding site, the AT-1, and AT-2 binding sites. The TATA-binding site and AT-1 site are located within the 5'LTR, while the AT-2 sites is located within the 5'UTR of copia element. The sequence protected by the AT-1 protein is ACTATTTATTTATTTATTAGAAAGG, (25'bp), located between nucleotides 227 and 252.

The AT-1 protein has a candidate region possessing a transactivation domain. No strong similarity in DNA sequence to known DNA-binding motifs was found in the AT-1 sequence. The amino acid sequence of the AT-1 protein, however, carries a high percentage of positively charged amino acids, consistent with a DNA-binding function for the AT-1 protein.

DOI

10.25777/q1wc-db57

Download

Share

COinS